World Science Scholars

3.6 Living the Life of a Gene Editor

discussion Discussion
Viewing 8 reply threads
    • In lesson 2.1 Repurposing Bacterial CRISPR for Human Gene Editing you were introduced to the example of sickle cell disease to illustrate the concept and promise of gene editing for human therapeutics, where the causative mutation could be repaired with CRISPR. You also learned about the molecular requirements necessary to harness CRISPR-Cas9 for gene editing: (1) the design of the 20-letter guide sequence, (2) the choice of a matching target sequence in the genome flanked by “NGG” (where “N” can be any letter of DNA), and the use of a repair template that contains the desired edit.

      Now, using this information, together with the actual DNA sequence of the mutated beta-hemoglobin gene that causes debilitating sickle cell disease in patients, you will propose a “guide RNA” sequence and “repair template” sequence to serve as starting materials for the therapeutic treatment of this disease. 

      In this Benchling file, you can see that the 7th codon of the hemoglobin beta gene, which normally has the sequence “GAG” and codes for the amino acid Glutamic acid (Glu), is mutated to GTG and instead codes for the amino acid Valine. (Remarkably, this single mutation is the entire cause of the sickle cell phenotype in red blood cells.) Your goal is to propose: 

      • a 20-letter guide sequence that directs Cas9 to cut somewhere close to the mutation, and 
      • a repair template that can be used by human cells, upon experiencing a CRISPR-Cas9-induced DNA break, to convert the mutated sequence back to the healthy sequence. Remember: for Cas9 to work properly, it must target a sequence in the gene that is next to a short motif (called the PAM), that reads “NGG”. 

      Refer back to lesson 3.5 Identify and Annotate a Real-life CRISPR-Cas System for introductory information on using Benchling, and propose a “guide RNA” sequence and “repair template” via the discussion or by uploading a file. Feel free to comment on each other’s thoughts. 

       

    • Cut GTG and add GGG

    • great

    • Ladies & Gentlemen,

      In blood testing this last summer, my red cell count is 138. This is low end, so the sickle cell humour is that croissant -like polarity exists.

      CLG

      Attachments:
      You must be logged in to view attached files.
    • Guide RNA Sequence:
      5’-AGTCTGAGGACCTGTTGCA-3’ (targeting near the mutation with PAM “NGG”).

      Repair Template:
      5’-CTGAGGAGGACCCTTGTAG [GAG mutation correction] TGCTG-3’ (including the corrected “GAG” sequence).

    • ARTTTT

    • 5’- CCTGACTCCTGTGGAGAAGT -3’

    • RNA guia: uma sequência de 20 nucleotídeos escolhida para direcionar a Cas9 a uma região próxima à mutação GTG, desde que exista um PAM (NGG) adequado.
      Molde de reparo: uma sequência de DNA contendo a versão saudável GAG no lugar da mutação GTG, juntamente com as sequências flanqueadoras necessárias para orientar o reparo.
      O objetivo é usar a quebra gerada pela Cas9 para que a célula utilize o molde e corrija a mutação responsável pela anemia falciforme

    • We are the DNA of the Ancient Ones. The Ancient Ones are our DNA. We are stuck in the loop of perpetual learning. We must never stop learning and developing the cerebral cosmic consciousness. Suffer, learn, teach, rinse, wash, and repeat. Evil, good, and everything in-between. We are information.

      #QuantumMinister

      Attachments:
      You must be logged in to view attached files.

You must be logged in to reply to this discussion.

Send this to a friend